Please note: All sequences are written in the 5' to 3' direction.
In order to figure out which guide sequence to input, identify the direction from the forward primer to the reverse primer. The guide sequences that you input to CRISPResso should always be in this direction.
Example:
In this case, since all input sequences are written in the 5' → 3' direction, and the forward to reverse primer direction is right to left, we can determine that the guide sequence will be on the reverse DNA strand, which is conventionally the bottom strand where the 5' → 3' direction is right to left.
The reference sequence that CRISPResso outputs is a certain number of nucleotides (determined by the quantification window parameter) upstream and downstream of the input guide sequence. Therefore, it will be on the same strand as the input guide sequence.
Example:
The sequence that should be translated to determine the amino acid sequence for a particular allele may not necessarily be the same as the CRISPResso reference sequence. The sequence that should be translated is what should be entered into the ref_seq column of the metadata input file for the BEV_allele_frequencies validation notebook. This reference sequence should be formatted such that introns (if applicable) are in lowercase.
In this case, the forward DNA strand is being translated, so the reference sequence for translation is the reverse complement of the reference sequence that CRISPResso outputs. Therefore, in this case the reference sequence for the notebook metadata file is tgtcttttctatgatctctttagGGGTGACCCAGTCTATT.
The rev_com parameter in the notebook input file determines which strand will be translated. The parameter is defined by the following:
In this case, since the guide sequence and CRISPResso reference sequence are on the reverse DNA strand, while the strand being translated is the forward DNA strand, rev_com is True.
Here is what the metadata file for the BEV_allele_frequencies notebook would look like for this example. Explanations for the rest of the columns can be found in the BEV_allele_frequencies notebook:
| sg | sgRNA_sequence | ref_seq | BEV_start | BEV_end | primer | frame | rev_com | BEV_ref | BEV_test |
|---|---|---|---|---|---|---|---|---|---|
| 397 | GTCACCCCTAAAGAGATCAT | tgtcttttctatgatctctttagGGGTGACCCAGTCTATT | 7 | 12 | F_C12_R_C12 | 2 | True | 5;6 | 9;10 |
In this case, since the guide sequence, CRISPResso reference sequence, and translation sequence are all on the forward DNA strand, rev_com is False.
Here is what the metadata file for the BEV_allele_frequencies notebook would look like for this example:
| sg | sgRNA_sequence | ref_seq | BEV_start | BEV_end | primer | frame | rev_com | BEV_ref | BEV_test |
|---|---|---|---|---|---|---|---|---|---|
| RDA407 | CTGGACTCTGGAATCCATTC | GCTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTGCCACTACCACAGCTCCTTCTCTGAG | 41 | 42 | F2_R2 | 1 | False | 01;02 | 41;42 |